haru2250 haru2250

12-04-2024
Mathematics

contestada

For the equation below with linear coefficients, determine the substitutions x=u+h and y=v+k that will make the equation homogeneous in u and v. (-4x-y-1)dx+(x+y+3)dy=0?

Respuesta :

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

what are the short term affects of decline in bee population?

Foreign-trade zones are: a. Bodies of water where cargo ships are allowed to dock to deliver imported goods b. Secure sites within the U.S. where goods and mate

Subtract 9x^2-7x9x 2 −7x from -4x^2+6−4x 2 +6.

Which of the following description is NOT correct regarding "half-life" in an exponential decay problem? A. Half-life is the length of time it takes an exponent

Word: devised What is it? (at least 3 synonyms) 1. 2. 3. What is it not? (at least 3 antonyms) 1. 2. 3. Definition in your own words Your own made up sentence u

What is 1+1 but multiplied by 2?

D(1) =3 D(n) = d(n-1)-14

Here you go good luck guys!

You can use a convex lens (or magnifying glass) to converge the sun light into a single point and burn a hole in paper (or burn an ant on the ground). That poin