jakecampbell05pbovbs jakecampbell05pbovbs
  • 11-07-2018
  • Mathematics
contestada

a gardener has a rectangular garden with a length of 10 feet and a width of 5. the Gardner plans to increase the length of the garden by 3 feet what will the area of the enlarged garden be

Respuesta :

kaceybates12 kaceybates12
  • 11-07-2018
The area of the enlarged garden will be 4,225 feet
Answer Link

Otras preguntas

why did russia have revolution in 1917?
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
the bombing of Hiroshima and Nagasaki resulted in
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
What does hemostasis mean?
does radiation need a phase of matter to travel with?
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit