rebelfighter24ovin5h rebelfighter24ovin5h

01-10-2018
Mathematics

contestada

Write each equation in slope-intercept form of the equation of a line. Underline the slope and circle the y-intercept in each equation.

3x+4y–12=0
2x+y=1

Respuesta :

altavistard altavistard

01-10-2018

First equation: 3x+4y-12=0. Solving for 4y, we get 4y = -3x + 12, from which

y = (-3/4)x - 3. The slope is -3/4 and the y-int. is -3.

Second equation: 2x + y = 1. y = -2x + 1. The slope is -2 and the y-int. is 1.

Answer Link

Otras preguntas

how was the effect of imperialism on india similar to its effects on hatiti

) Healthy Living, a diet magazine, collected $240,000 in subscription revenue on May 31. Each subscriber will receive an issue of the magazine in each of the ne

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

1. Consider a head-on collision between two identical billiard balls. Ball 1 is initially in motion toward ball 2, which is initially at rest. After the collisi

18h^3 + 45h^2 - 8h - 20

Which of the following best states Mallon’s purpose in writing this letter?

Which personality type would a salesperson most accurately classify with? Creator (Artistic) Helper (Social) Persuader (Enterprising) Organizer (Conventional)

Describe one method to calculating the area of the shaded region.

Solve for x. Write both solutions, separated by a comma. 5x^2 + 2x -- 7 = 0

In astronomy, distances are often expressed in light-years. One light-year is the distance traveled by light in one year. If the distance to a star is 3.6 light