alexvillaa121 alexvillaa121

04-02-2019
Computers and Technology

contestada

Including a space in the file name causes problems on all operating systems?

Respuesta :

dorikan dorikan

11-02-2019

Correct answer is NO,

but we should avoid using spaces in file name

Answer Link

Otras preguntas

Expand. If necessary, combine like terms. (3+4.)(3 - 4x) =

What is the largest percentage of land use in the United States?

When making a batch of orange juice for her basketball team Jackie used 5 times as much water as concentrate. There were 32 more cups of water than concentrate.

Solve for a: 5a – 5 = 4a + 4

As of a certain date, 94,696 of the four-character sequences using either letters or digits had not yet been claimed. If a four-character name is randomly selec

Help, contain picture

Give the characteristic of a second order reaction having only one reactant. Group of answer choices The rate of the reaction is proportional to the natural log

After soccer practice coach Miller goes to the roof of the school to retrieve the event soccer balls the height of the school is 3.5 m a soccer ball which leave

mrs.bonnett's recipe for banana bread calls for three and one fourths cups of sugar. she wants to make 6.5 batches so that she has enough for everyone. how much

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template