DiamNeli
DiamNeli DiamNeli
  • 01-03-2019
  • Mathematics
contestada

Help on number 20 please?​

Help on number 20 please class=

Respuesta :

choixongdong
choixongdong choixongdong
  • 01-03-2019

Answer:

1/8

Step-by-step explanation:

P(-3, 0) and Y(5,-1)

If PLAY is reflected over x-axis, then P-->P'(-3,0) and Y-->Y'(5,1)

Slope of P'Y' = (1 - 0)/(5+3) = 1/8

Answer Link

Otras preguntas

The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u
If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system
-( x + 4 ) = 2x + 35
World war 2 officially began with hostilities between what two nations A. Japan and the United States B. Germany and Poland C. Japan and China D. Germany an
what is 3(2x-4)=5x+2
Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens
Which is a characteristic of cancer cells? predictable, uniform cell division evidence of cellular cohesiveness uniform size and shape poor differentiation?
How did immigration affect immigrants and other americans in the 1900s?
Which are True or False ?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat