ella574 ella574
  • 01-05-2019
  • History
contestada

What were the gaols of U.S foreign policy in the Cold War?​

Respuesta :

andrew9040
andrew9040 andrew9040
  • 01-05-2019

These goals were: It would lead to the recovery of production abroad, which was essential both to a vigorous democracy and to a peace founded on democracy and freedom, and which, in the eyes of the United States, the Soviet Union had thus far prevented.

Answer Link

Otras preguntas

Arrange the steps in the correct order for creating a digital image and saving it.
What is the requirement when ratifying a proposed amendment to the United States Constitution? A. approval of three quarters of states in a state convention B.
PLEASE HELP ME!! What was the name of the system developed by FDR Roosevelt during the Great Depression to aid lower income people? B) Medicare C) M
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The Hellenistic age was characterized by all of the following EXCEPT
For some time, the English had little interest in colonizing for what two reasons?
Help! Exponential Equation WITHOUT CALCULATOR
what was considered an act of war in 1914?
Hafsah is feeling upset lately. Which questions should Hafsah ask herself to determine whether she needs to seek professional mental health services? Check all
Arrange the complex numbers in order according to the quadrant in which they appear, starting with the first quadrant. Tiles: 3 − 4i -1 − 3i 4 + i -2 + 2i