sapienceobservatorya
sapienceobservatorya sapienceobservatorya
  • 01-07-2019
  • Chemistry
contestada

What will happen to the pH of a buffer if acid/base ratio is increased by 100?
plz respond within an hour :)

Respuesta :

znk
znk znk
  • 02-07-2019

Answer:

It will decrease by 2 units.

Explanation:

The Henderson-Hasselbalch equation for a buffer is

pH = pKa + log(base/acid)

Let's assume your acid has pKa = 5.

(a) If the base: acid ratio is 1:1,

pH(1) = 5 + log(1/1) = 5  + log(1) = 5 + 0 = 5

(b) If the base: acid ratio is 1:100,

pH(2) = 5 + log(1/100) = 5  + log(0.01) = 5 - 2 = 3

(c) Difference

ΔpH = pH(2) - pH(1) = 5 - 3 = -2

If you increase the acid:base ratio to 100:1, the pH will decrease by two units.

Answer Link

Otras preguntas

Step by step directions Square root for 480
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Do all your pet's offspring look the same? If no, then explain why they look different.
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
i need help with #3
does a human body use neon???
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5