anaisahippo
anaisahippo anaisahippo
  • 01-04-2020
  • Biology
contestada

DNA is passed from parent to offspring to determine the traits of offspring true or false

Respuesta :

shaelyn1017 shaelyn1017
  • 01-04-2020
The answer would be true
Answer Link
TreSwervo TreSwervo
  • 01-04-2020

Answer:

Scientists also know that the DNA that makes up genes is packed into structures ... which he called traits, were passed down to successive generations. ... of parental elementen then determined which form of a trait was visible in the offspring. ..

Answer Link

Otras preguntas

individual candidates running for _____ must be natural-born citizens who have held residency in the united states for at least 14 years and are at least 35 yea
[tex]what 7.99+90[/tex]
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What step of the scientific method might be the most difficult when studying creature's that lived millions years ago
pls help!Eva is short on frosting! She works in a bakery and has 12 cakes to frost, but she is short 4 1/8 cups on the amount of frosting required. She decides
The function of carbohydrates is to ___________________ Select one: a. act as a layer of insulation b. control the rate of chemical reactions c. provide the mai
North Carolina had about 100,000 slaves in 1790. How many of these would count toward the state's representation in Congress? i know no one will answer but heck
El ESTEREOTIPO ETARIO consiste en discriminar a las personas por
Your carbon footprint can be defined as?
Answer this and I’ll buy you McDonald’s