wwwbryandaaguilar200 wwwbryandaaguilar200
  • 03-04-2020
  • Biology
contestada

Which of the following replicates prior to mitosis

Respuesta :

charleerocksandrolls charleerocksandrolls
  • 16-04-2020

Answer:

The S phase of a cell cycle occurs during interphase, before mitosis or meiosis, and is responsible for the synthesis or replication of DNA. In this way, the genetic material of a cell is doubled before it enters mitosis or meiosis, allowing there to be enough DNA to be split into daughter cells.

Explanation:

Answer Link

Otras preguntas

What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false
How do you find x ????
Abraham lincoln's and andrew johnson's reconstruction plans shared an emphasis on
what is r in this equation? πr^2=42π
What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
if the accuracy in measuring the position of a particle increases, what happens to the accuracy in measuring its velocity?
Helppppp how do u do this????