21000424 21000424

01-05-2020
Mathematics

contestada

Which is the correct simplified form of the expression? (HELP)

Which is the correct simplified form of the expression HELP class=

Respuesta :

gracielpifer gracielpifer

01-05-2020

The answer should be option C! I think? I hope it helps :)

Answer Link

Otras preguntas

When George attends the first day of an Advanced Placement class in biology, he thinks to himself, This is going to be a really hard class. I don't know if I ha

Suppose that an individual has a body fat percentage of 17.8% and weighs 152 pounds. How many pounds of his weight is made up of fat? Round your answer to the

What is the slope of the line that passes through the points (3,6) and (1, 2)? Write your answer in simplest form. HELP

Given the three function below, which expression equals (z\circ h \circ s)(x)(z∘h∘s)(x)? h(x)=4x\hspace{50px}s(x)=2^{x}\hspace{50px}z(x)=\frac{3}{x-8} h(x)=4xs(

a taxi driver charges $2.50 per mile in addition to a $5 service fee. what is the equation that represents y, the total cost for x miles? pls show explanation

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

What’s is the index notation?

A contact list is a place where you can store a specific contact with other associated information such as a phone number, email address, birthday, etc. Write a

Translate the vegetables into Spanish by filling in the missing letters: _as _rd_ra_

| 3. Write the decimal equiva a. 19% = e. 3% = Copyright © mmx Pensacola Christian College. N