sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

rewrite these sentences into the passive voice 1 They make noodle from flour.

Re-write each verb and object into an usted or ustedes command with a direct object pronoun. Place the pronoun in the correct location and add an accent to the

write a letter to your friend in Paris telling him about your new SHS School in French

how to write a story ending with the words:"Never will I do that again"

why does the structure of the plasma membrane make this type of transport neccesary for fluids

What information should be included in a works cited page? Check all that apply. O names of publishing companies names of authors O definitions of key terms Oda

3. State Newton's first and second laws of equation. A. A body of mass 2kg move vertically upwards has its velocity increased uniformly from 15m/s to 45m/s in 5

Two friends, Vani and Shaquana, took summer jobs. The equation y=28.8xy=28.8x represents Vani's earnings in dollars and cents, yy, for working xx hours. Shaquan

what is special education

Consider the matrix [tex]A_{4x4}, det(A) = -2[/tex]Show that the following is true or false:[tex]det(adj(2A^{-1}) =-2^{9}[/tex]