xmidizu xmidizu

03-09-2020
Mathematics

contestada

Solve for x. Show steps.

1. 3x = 2x + 2

2. 3x + 5 = 4x + 1

3. 6x + 3 = 3x + 12

Respuesta :

iarnold0002 iarnold0002

03-09-2020

Answer:

1: x=2, 2: x=4, 3:x=3

Step-by-step explanation:

They are correct because i checked them

Answer Link

Otras preguntas

Which statement describes a similarity between the state and the federal governments?

if 6+7=41 then what is 7+8=

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

if a circle has a radius of 2 ft. is the circumfrence and area the same? Explain

suppose that the equation n=700(0.2) to the power of 0.5t represents the nulber of employees working t years after the opening of a new company how many employe

Name five places on the farm in French?

A light bulb factory produces 1,188 light bulbs every hour. Approximately 3.83% of the light bulbs are defective, and do not work. Using the binomial distributi

what words would you use to describe the main ideas or principles, of the Constitution?

The sum of two numbers is 8, and their difference is 22

What is the answer to:1+4=5 2+5=12 3+6=21 5+8=