clovermimibabe
clovermimibabe clovermimibabe
  • 02-10-2020
  • English
contestada

What is change and what dose it do

Respuesta :

bluewolf52
bluewolf52 bluewolf52
  • 02-10-2020

Answer:

What is Change?

The Definition of Change: To make someone or something different. To modify or alter.

What does Change do?

Change alters and makes someone or something different

Explanation:

Synonyms:  

alter, make different, become different, undergo a change, make alterations to...

Antonyms: preserve, stay the same

I hope I have helped! :)

Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
M<2 64 and m<4 =2x-6
f(x)= 2x/x+1 use long division to rewrite​
Doug bought 9 new country songs and 5 new rock songs for his music player. If his player randomly selects one of the new songs Doug just bought to play, what is
The form of resource (input) substitution where one input can be exactly substituted for another in production is known as: Select one: a. Perfect substitutes b
Please help!!! 2x²-5x-12 (quadratic equations) Explain your work and describe the solution. I really appreciate it!
One of the disadvantages of issuing stock is that
V6 +x= 3 when x = 21
A nature center offers 2 guided walks. The morning walk is two-third mile. The evening walk is three-sixths mile. Which walk is shorter? Explain how you can use
Whats x? pls hurry huge reward.this one for u kolmp