sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

in the Spanish-speaking world which of the following is a culturally important practice that takes place after meal

if x and y are positive integers and 3x+2y=13 what could be the value of y

what is the commutative property of addition to rewrite 10+8=18 in a number sentence

What is the answer to 6[3+7(4-2)]

how many thousands are in 50000

If your heart is not strong enough or efficient enough it is difficult to

21,000 round to the nearest ten thousand

What is 6,007,200 and 32,005,008 in expanded form?

what's a root word for geographer

What are 2 food making processes