Jens3am0aerBritta Jens3am0aerBritta

01-10-2016
Mathematics

contestada

the difference between a number and two times a number is seven the number is greater than zero what is the number

Respuesta :

SamreenAmdani SamreenAmdani

02-10-2016

7 is the answer

2x - x = 7
x = 7

Answer Link

Otras preguntas

Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?

The section of the small intestine between the duodenum and ilium?

CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n

Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?

Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for

which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

what are the 2 major types of cofactors?

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system