video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

Tim works as a server in a restaurant. A group for $112.50. They leave Tim a tip of 20%. Another group at Table 15 have a bill of $142.75 and leave a 15% tip. W
If A= and then find : 2A + 3B​
Can somebody help me
find the LCM of 220,440,660 by common division method​
Write in a shorter form:7m -7 +7m +7​
Can you give me an example of medicine that developed throughout the 20th century.
Why are sharks important in ecosystem
Which method of birth control works by delivering a daily dose of estrogen and/or progesterone in order to prevent ovulation and changes in the lining of the ut
The value of (2+3)(2-3) is​
Classify the descriptions as pertaining to nucleosides, nucleotides, or both nucleosides and nucleotides. a. Do not contain a phosphate group b. The product w