pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

Iron (2) Chloride reacts with sodium oxide to form...?
As an electron approaches a proton, the electric force of attraction A. decreases B. increases C. remains the same
What is the typical educational requirement for a non-entry level software programmer?
“I’m sad to see the bookmobile go,” said Ms. Tomlinson, “because it brings the library to people who find it hard to come to us.” These people include disadvanta
plz help i don't understand
A child of a specific set of parents has a 0.2 chance of having type O blood. Suppose these parents have 4 children. Let X=the number of children having type O
What is the period of a 1.00 m long pendulum?
could someone please help me with this question
which is the more powerful of the two: house of lords or house of commons
How was the Italian city-states run during the Italian Renaissance?