raspberryy raspberryy
  • 01-10-2021
  • Mathematics
contestada

What is 4x+3 = 5x
:))

Respuesta :

Tasyha
Tasyha Tasyha
  • 01-10-2021

Answer:

x = 3

Step-by-step explanation:

4x + 3 = 5x

4x = 5x - 3

4x - 5x = -3

(4 - 5)x = 1x

-1x = -3

x = -1 × (-3)

x = 3

Answer Link

Otras preguntas

I need help with this!
5 employees with annual salaries of 50000 60000 50000 70000 90000 what is the annual mean
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
Translate the sentence into an equation: three is 5 more than a number
1) 2/5÷1/102)48.4÷0.004​
Explain why some systems of equations have no solutions, why some systems have one solution, and why some systems have infinite solutions.
Explain how you would use addition to find the product of -2 and 5 using the integer tiles and the number line?
how many days does it take the moon to revolve around the earth
James has 858 feet of rope. There are 18 teams of hikers. If James gives an equal amount of rope to each team, how much rope will each team receive? The answer
if a ray QT bisects <RQS, what will be the measure of one of the resulting angles?mZTQS=​