Patrick2122 Patrick2122
  • 02-11-2021
  • Social Studies
contestada

which mascot was inspired by a drawing on a fogged window

Respuesta :

Ry7777
Ry7777 Ry7777
  • 02-11-2021

Answer: The Kool Aid Man

General Mills' rather rotund character was created in 1954 by Marvin Plotts, who was inspired by watching his son draw on a foggy window.

Explanation:

Answer Link

Otras preguntas

The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
2ln(5x)=8 solve for x
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Do you think then solid can undergo convection
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5