kiareyeranton kiareyeranton
  • 04-01-2017
  • Computers and Technology
contestada

Which type of image uses lossy compression to reduce file size?
a. jpg
b. bmp
c. tif
d. raw?

Respuesta :

rsmith6559
rsmith6559 rsmith6559
  • 05-01-2017
A jpg.
--------------------------------------
Answer Link

Otras preguntas

A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
What is the additive inverse of -4a
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Please help solve, thanks in advance!
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
what is 15/24 in simplest form
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5