leobottinger1942 leobottinger1942

03-02-2022
Mathematics

contestada

What is the distance between the points (15 , -16) and (-8 , -16) in the coordinate plane?

Respuesta :

solvingyourproblems solvingyourproblems

05-02-2022

Answer:

15

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi

An account earns simple interest. Find the annual interest rate, I= $60 P= $500 t= 2 years

Byron uses a poetic technique called _____ to force the reader to _____. A. enjambment; move from one line to the next without pause B. iambic pentameter; pa

On a number line, let point p represent the largest integer value that is less than 407. le point q represent the largest integer value that is less than 68 − .

How did new industrial technologies influence the course of world war i?

In "no witchcraft for sale," why are the farquars particularly happy when teddy is born?

For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile

6. Rewrite each of the following durations using eighth notes. Write in words and as a fraction: a. 1 quarter note b. 1 half note c. 1 full note

4 (2x-6)=10x-6. solve for x