imanimoten07
imanimoten07 imanimoten07
  • 04-03-2022
  • Biology
contestada

What is photosynthesis and cellular respiration reactants

Respuesta :

Lethality
Lethality Lethality
  • 04-03-2022

The products and reactants for photosynthesis are reversed in cellular respiration: The reactants of photosynthesis are carbon dioxide and water, which are the products of cellular respiration. The reactants of cellular respiration are oxygen and sugar, which are the products of photosynthesis.

Answer Link

Otras preguntas

find the prime factorization 504
does a human body use neon???
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
How did the mountains in Greece contribute to the rise of city-states?
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
Help pl0x, Algebra 1
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D