annacmiel1634 annacmiel1634
  • 03-02-2017
  • Mathematics
contestada

How do I do this problem?

How do I do this problem class=

Respuesta :

bryantroutman
bryantroutman bryantroutman
  • 03-02-2017
Simple geometry:
Use the information that you have to determine the angle BGY = MGK and Y = 55°
Because the triangles are the exact same but flipped along the y axis, K = 55°
Hope this helps
Answer Link

Otras preguntas

A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
in what area of Europe were the majority of warsaw pact countries
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
Do you think then solid can undergo convection
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how do you say theatre in Spanish
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before