pink211 pink211
  • 01-11-2017
  • Biology
contestada

What action should the nurse take for compartment syndrome?

Respuesta :

tejanoajet
tejanoajet tejanoajet
  • 01-11-2017
The nurse should administer pain killers and document any relief, elevate the problem area no higher than heart level because arterial pressure has to be balanced. Also, apply cold packs and remove any bandages, tight clothing, jewelry or anything that can constrict the limb. 

In those cases when there's an infection and drainage is required the nurse should give the patient instructions and try to pacify them and get them to express their concerns. 
Answer Link

Otras preguntas

what is the lcd of 10/11,29/44
where are the three parts of an atom located
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
four yardequal Blank feet
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
3+1/4x greater than 11
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want