deme2 deme2
  • 02-02-2016
  • Mathematics
contestada

express the fraction 1/2 3/16

Respuesta :

N3wt N3wt
  • 02-02-2016
If this means 1/2 x 3/16 then you multiply the top (1x3=3) and the bottoms (2x16=32) to give 3/32 which does not simplify further
Answer Link

Otras preguntas

A light bulb converts electrical energy into electromagnetic energy is true or false?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
Please help with Algebra 1
What is the additive inverse of -4a
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October