talyacalhoun talyacalhoun
  • 03-04-2018
  • History
contestada

What moviated Picasso to create his large-scale painting Guernica for the spanish Pavilion at the 1938 Paris Exposotion?

Respuesta :

lovecalum96
lovecalum96 lovecalum96
  • 03-04-2018
It was a response to the German bombing of a small Basque town, sponsored by Spanish Nationalists
Answer Link

Otras preguntas

How and where (at what latitudes) do atmospheric convection cells form?
It takes 10 workers 24 hours to do a job. Fill in the chart.
List and briefly describe each of the five strength training principles. (Site 1)
With this sole proprietorship, who pays the taxes?
Personal care quiz---when providing nail care it is important to consult a professional true or false
How do you find x ????
what is 3/5 of 21? plz answer the question
punctuated equilibrium definition biology
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the area of this composed figure