Nanphogh6ikbx Nanphogh6ikbx

02-04-2016
Social Studies

contestada

differences between catholic and christian

Respuesta :

06-04-2016

There is nothing different, you are a christian if you believe that Jesus died for you sins and catholics believe that!

Answer Link

Otras preguntas

PLEASE HELP! A right triangle is formed in the first quadrant by the x- and y- axes and a Straight line through the point (2,3). The other vertices are (0,0) (

Yo ________ en el mar.A. nadó b. nadé c. nadamosI will give Brainliest for the best answer!!!!!!please help!!!!!

What is the charge of cobalt in CoCl2?

Maxine Frase plans to bake 12 dozen peanut butter cookies. She will use a recipe inmperial más. The cookies are baked at 360 °F for 20 minutes.Ingredients to ma

Use the information given to enter an equation in standard form. (9, 10) and (8, 7) are on the line.

Please help it’s for my test I’ll give points to who ever is correct and gives an honest answer

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Explain how you can locate the Pole Star with the help of Ursa Major?

Express 150 as: a) A fraction of 350. b) A percentage of 600.

I really need help with this no sum answers or else. You will get 20 points and brain list Calculate the percent or value requested 1.of 900 is 369 2. Of 100 is