alexiswhiteman alexiswhiteman
  • 01-11-2016
  • History
contestada

which term is most closely associated with Hellenism under Alexander the Great?

a)cultural diffusion
b)pacifism
c)natural rights
d)theocracy

Respuesta :

Aquamine
Aquamine Aquamine
  • 01-11-2016
I think it has to be C but B look good to 
Answer Link

Otras preguntas

In a right triangle with a leg of 2 in and a leg of 3 in what is the hypotenuse?
Five men and eight women work in a firm’s PR office. Their employer must choose two of them to attend a conference in Chicago. What is the probability of choosi
help please :) acellus
Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG
LBJ's domestic policies, also known as the Great Society policies were created to do what Select One:Use tax dollars to provide books to low income & segreg
By 1600, the Christian faith that was once a common bond in Europe had become a source of celebration. True False
Identify the value of r and a1 for each geometric series. 8 + 4 + 2 + 1 + ...
According to this dictionary definition, which sentence uses the word voracious correctly?
Hitler invaded the Soviet Union to _____________. a. expand his territory c. get closer to defeating the British b. obtain resources d. all of the above
like terms as 6p²q is?​